Stem-loop sequence gga-mir-6664

AccessionMI0022484 (change log)
DescriptionGallus gallus miR-6664 stem-loop
Stem-loop
   auuccugagugggaug     uu -   -g        c     ag   -u  ---g      
5'                 gcaac  u ccc  agccucca cauca  ccu  gu    cuggc 
                   |||||  | |||  |||||||| |||||  |||  ||    |||| c
3'                 cguug  a ggg  ucggaggu guggu  gga  ca    gacca 
   ---------ugggaga     uu c   ag        c     aa   cu  ggga      
Get sequence
Deep sequencing
31 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr20: 640878-640987 [-]
sense
ENSGALT00000001868 ; SAMHD1-201; intron 11
Database links

Mature sequence gga-miR-6664-3p

Accession MIMAT0025765
Sequence

70 - 

caggaauggugcuggaggcuga

 - 91

Get sequence
Deep sequencing30 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).