Stem-loop sequence gga-mir-6665

AccessionMI0022485 (change log)
DescriptionGallus gallus miR-6665 stem-loop
Stem-loop
   cuccaaaaauc     cu        --     a       u   -     gaaauga 
5'            gagau  gcaaagcu  gccug aggauuu gau gcccu       a
              |||||  ||||||||  ||||| ||||||| ||| |||||       g
3'            cucua  uguuuugg  cggac uccugag cug cggga       g
   ------ccuga     uu        gc     c       u   u     aagaaag 
Get sequence
Deep sequencing
27 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr8: 5229603-5229712 [-]
sense
ENSGALT00000021887 ; PBX1A-201; intron 6
ENSGALT00000005426 ; PBX1A-202; intron 6
ENSGALT00000005425 ; PBX1A-203; intron 6
Database links

Mature sequence gga-miR-6665-5p

Accession MIMAT0025766
Sequence

26 - 

ugccugaaggauuuugaugccc

 - 47

Get sequence
Deep sequencing4 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).