Stem-loop sequence gga-mir-6666

AccessionMI0022486 (change log)
DescriptionGallus gallus miR-6666 stem-loop
Stem-loop
   ------- ag     gg           -a      ca     u gu  cu  --    u 
5'        g  agaac  gaauuuagggg  cuccug  cucgu c  cc  gc  gcug g
          |  |||||  |||||||||||  ||||||  ||||| |  ||  ||  |||| a
3'        c  ucuug  uuugaguccuu  gaggac  gagua g  gg  cg  ugac u
   uaucgac cu     --           ag      ag     - ug  cu  uc    g 
Get sequence
Deep sequencing
27 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr28: 4722719-4722828 [+]
sense
ENSGALT00000006443 ; PTPRS-201; intron 11
Database links

Mature sequence gga-miR-6666-3p

Accession MIMAT0025767
Sequence

63 - 

ucgggugaugaggacaggagga

 - 84

Get sequence
Deep sequencing27 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).