Stem-loop sequence gga-mir-6667

AccessionMI0022487 (change log)
DescriptionGallus gallus miR-6667 stem-loop
Stem-loop
   -----ggagaguuggcaggcugugagg   a    ----ag         -a     gg 
5'                            gug ggga      guggcaagc  uguuu  g
                              ||| ||||      |||||||||  |||||  c
3'                            cac cccu      caucguucg  acgag  u
   uagguccgacagaaaacggcagcggga   -    guucua         ag     gg 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr11: 19007943-19008052 [+]
sense
ENSGALT00000009926 ; CDK10-201; 3'UTR (exon 12)
Database links

Mature sequence gga-miR-6667-5p

Accession MIMAT0025768
Sequence

26 - 

agggaagguggcaagcauguu

 - 46

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).