Stem-loop sequence gga-mir-6668

AccessionMI0022488 (change log)
DescriptionGallus gallus miR-6668 stem-loop
Stem-loop
   -      auccuguu   c          au   g    a           aug 
5'  ugggug        ggu uuuucuaacc  ggu auuc augauucuaug   u
    ||||||        ||| ||||||||||  ||| |||| |||||||||||   g
3'  acccac        cca ggaagguugg  ucg uaag ugcuaagguac   u
   g      ccguaagu   c          gu   a    g           cgu 
Get sequence
Deep sequencing
285 reads, 20 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr4: 34288536-34288645 [+]
intergenic
Database links

Mature sequence gga-miR-6668-3p

Accession MIMAT0025769
Sequence

62 - 

uggaaucguggaauagcuugggu

 - 84

Get sequence
Deep sequencing9 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).