Stem-loop sequence gga-mir-6670

AccessionMI0022490 (change log)
DescriptionGallus gallus miR-6670 stem-loop
Literature search

1 open access papers mention gga-mir-6670
(1 sentences)

Stem-loop
   -------  u ug  ug    --g   -a        -   -        -u     uua 
5'        ga g  uu  ucuu   auu  guggaaug aug aucuauau  cugag   a
          || |  ||  ||||   |||  |||||||| ||| ||||||||  |||||   u
3'        cu u  ga  agaa   ugg  uacuuuau ugc uagaugug  gauuc   u
   uaaguua  u uu  gu    aca   aa        a   g        uu     uuu 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr3: 79870059-79870168 [+]
sense
ENSGALT00000025610 ; PHIP-201; intron 25
Database links

Mature sequence gga-miR-6670-5p

Accession MIMAT0025772
Sequence

20 - 

guggaaugaugaucuauauucugagu

 - 45

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).