Stem-loop sequence gga-mir-6671

AccessionMI0022491 (change log)
DescriptionGallus gallus miR-6671 stem-loop
Stem-loop
   --  ggaa  aaa    - a       cug     g   cuc u      g  caa 
5'   gc    gg   gcag c uugcagc   uccug agu   g gcacac ug   a
     ||    ||   |||| | |||||||   ||||| |||   | |||||| ||    
3'   cg    cc   cguu g aacgucg   aggac uca   c cgugug ac   c
   cu  -aga  aga    u g       uca     g   cca u      g  uca 
Get sequence
Deep sequencing
10 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr24: 5039305-5039414 [+]
intergenic
Database links

Mature sequence gga-miR-6671-5p

Accession MIMAT0025773
Sequence

26 - 

uguccuggagucucgugcacac

 - 47

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).