Stem-loop sequence gga-mir-6672

AccessionMI0022492 (change log)
DescriptionGallus gallus miR-6672 stem-loop
Stem-loop
   gugagga   --ag     g uu   auc   ---       -g       g    agg 
5'        cug    ucaga a  ggc   ccu   uuucagu  gugccca ugcc   a
          |||    ||||| |  |||   |||   |||||||  ||||||| ||||   c
3'        gac    agucu u  ucg   gga   aagguca  cacgggu acgg   a
   ---gacg   caca     g -u   -gc   cag       aa       g    gga 
Get sequence
Deep sequencing
75 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 112625566-112625675 [+]
intergenic
Database links

Mature sequence gga-miR-6672-3p

Accession MIMAT0025774
Sequence

65 - 

ugggcacaaacuggaagaca

 - 84

Get sequence
Deep sequencing30 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).