Stem-loop sequence gga-mir-6673

AccessionMI0022493 (change log)
DescriptionGallus gallus miR-6673 stem-loop
Stem-loop
   gu   aca     --   cu           uc cc          -   gg  ua 
5'   gcu   uggug  gau  gcacaguacau  c  uuucaggugu ugu  aa  g
     |||   |||||  |||  |||||||||||  |  |||||||||| |||  ||  g
3'   cgg   aucac  cug  ugugucgugua  g  agaguccacg aca  uu  c
   --   aag     ga   uc           ga ua          g   aa  ca 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr15: 8905698-8905807 [-]
sense
ENSGALT00000010946 ; DEPDC5-201; intron 34
Database links

Mature sequence gga-miR-6673-3p

Accession MIMAT0025775
Sequence

69 - 

accugagaaugagaugugcugu

 - 90

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).