Stem-loop sequence gga-mir-6674

AccessionMI0022494 (change log)
DescriptionGallus gallus miR-6674 stem-loop
Stem-loop
   ugcuuagguaaucaccaugcaa   --u   u   a      c    u   u a    caga 
5'                       ggc   cag ggg gaggcu ucac ggc c uggu    a
                         |||   ||| ||| |||||| |||| ||| | ||||    g
3'                       ccg   guc ccc cuccga ggug cug g accg    a
   --------------acuuucuu   ugu   -   a      c    u   u g    aagg 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr20: 2236551-2236660 [-]
sense
ENSGALT00000034635 ; ZNF341-201; intron 2
ENSGALT00000004694 ; ZNF341-202; intron 2
Database links

Mature sequence gga-miR-6674-3p

Accession MIMAT0025776
Sequence

70 - 

caggugucuguggcagccuca

 - 90

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).