Stem-loop sequence gga-mir-6675

AccessionMI0022495 (change log)
DescriptionGallus gallus miR-6675 stem-loop
Stem-loop
   -----------uuug    cuc     ac         g     uu  -  --     aga 
5'                gggc   cugcc  cauacguga guuca  gg gu  uccau   g
                  ||||   |||||  ||||||||| |||||  || ||  |||||    
3'                cucg   gacgg  gugugcacu caggu  cu ca  gggua   c
   ugagaagacacguga    -ua     ga         g     cu  a  uu     cgu 
Get sequence
Deep sequencing
38 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr24: 3341724-3341832 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-6675
gga-mir-100chr24: 3335097-3335176 [+]
gga-mir-6675chr24: 3341724-3341832 [+]
gga-let-7a-2chr24: 3343196-3343267 [+]
Database links

Mature sequence gga-miR-6675-5p

Accession MIMAT0025777
Sequence

20 - 

auacgugagguucauuggguuc

 - 41

Get sequence
Deep sequencing5 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6675-3p

Accession MIMAT0025778
Sequence

63 - 

ucucuggacgucacgugugagg

 - 84

Get sequence
Deep sequencing33 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).