Stem-loop sequence gga-mir-6676

AccessionMI0022496 (change log)
DescriptionGallus gallus miR-6676 stem-loop
Literature search

1 open access papers mention gga-mir-6676
(1 sentences)

Stem-loop
   ----ag   g     ggga      gagaug aug           gga   ga   au g 
5'       cag gcacu    gggacu      c   cagggacauug   ggg  cag  u a
         ||| |||||    ||||||      |   |||||||||||   |||  |||  |  
3'       guc ugugg    uccugg      g   gucucuguagu   ccc  guc  g a
   ggggga   g     ---g      ------ gga           -aa   gg   ac a 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 907622-907731 [-]
sense
ENSGALT00000012992 ; ZC3HC1-201; intron 1
Database links

Mature sequence gga-miR-6676-3p

Accession MIMAT0025779
Sequence

68 - 

gcccaaugaugucucugaggggg

 - 90

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).