Stem-loop sequence gga-mir-6677

AccessionMI0022497 (change log)
DescriptionGallus gallus miR-6677 stem-loop
Stem-loop
   ---------------agcuuaa    -  cu       a   - c  cc      ac    uca 
5'                       ugca ag  ccuucuc cug c ug  cugagc  acca   a
                         |||| ||  ||||||| ||| | ||  ||||||  ||||    
3'                       acgu uc  ggaggag gac g ac  gacucg  uggu   g
   gucuuagggaaacgucccgcaa    g  au       -   u c  -a      --    uac 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr20: 13293639-13293747 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-6677
gga-mir-6677chr20: 13293639-13293747 [+]
gga-mir-1687chr20: 13296363-13296453 [+]
Database links

Mature sequence gga-miR-6677-5p

Accession MIMAT0025780
Sequence

20 - 

cucacugccugcccugagcacacca

 - 44

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6677-3p

Accession MIMAT0025781
Sequence

56 - 

ugcucagacacgucaggagga

 - 76

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).