Stem-loop sequence gga-mir-6678

AccessionMI0022498 (change log)
DescriptionGallus gallus miR-6678 stem-loop
Stem-loop
   --cacaaaacgau       -uu     a     agu      --         cca 
5'              agaguuc   gcuug uucuu   gaaguc  agguggggg   g
                |||||||   ||||| |||||   ||||||  |||||||||   u
3'              ucucaag   cggac gggaa   cuucag  uccaucuuc   u
   uggucacaggacu       uuu     -     -gu      gu         aaa 
Get sequence
Deep sequencing
837 reads, 75 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr3: 103172072-103172181 [+]
intergenic
Database links

Mature sequence gga-miR-6678-3p

Accession MIMAT0025782
Sequence

63 - 

uaccuuggacuucugaagggca

 - 84

Get sequence
Deep sequencing825 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).