Stem-loop sequence gga-mir-6679

AccessionMI0022499 (change log)
DescriptionGallus gallus miR-6679 stem-loop
Stem-loop
   --cau  gc  -acu   ug  -g     ug      a     -au    --cu   a 
5'      gu  cg    gag  gu  ccucg  gaagau ugguc   cacu    gug g
        ||  ||    |||  ||  |||||  |||||| |||||   ||||    ||| a
3'      ca  gc    uuc  ca  ggagu  uuucua accag   guga    cac g
   accau  -a  guuc   gu  ag     gu      -     gac    caau   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr4: 15621996-15622105 [-]
intergenic
Database links

Mature sequence gga-miR-6679-5p

Accession MIMAT0025783
Sequence

26 - 

uggaagauauggucaucacucugu

 - 49

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).