Stem-loop sequence gga-mir-6680

AccessionMI0022500 (change log)
DescriptionGallus gallus miR-6680 stem-loop
Stem-loop
   -----------------     gua   a      g a    ug   ua  ug       ug   
5'                  ccaag   ugu ugguau u ucau  gug  cu  gugaggg  gg 
                    |||||   ||| |||||| | ||||  |||  ||  |||||||  | c
3'                  gguuc   gua gucaua a agua  cgu  ga  uacuccc  cc 
   acgaccgucacgaccca     -aa   a      g -    gu   ug  gu       gu   
Get sequence
Deep sequencing
20 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr21: 2632687-2632796 [+]
intergenic
Database links

Mature sequence gga-miR-6680-3p

Accession MIMAT0025784
Sequence

64 - 

guugcugaugaagauacugaau

 - 85

Get sequence
Deep sequencing20 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).