Stem-loop sequence gga-mir-6681

AccessionMI0022502 (change log)
DescriptionGallus gallus miR-6681 stem-loop
Stem-loop
   acaacuca     a   -ucu  u  uu --u     -   aa         gug  g 
5'         gagag cgg    gg gc  c   ggauc gag  auucagcau   cu g
           ||||| |||    || ||  |   ||||| |||  |||||||||   ||  
3'         cucuc guc    cc cg  g   ccuag cuc  uaagucgua   gg a
   ---uuuuc     g   uucu  -  uc uuu     u   ag         aua  a 
Get sequence
Deep sequencing
16 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr20: 8606306-8606415 [-]
sense
ENSGALT00000009067 ; gga-mir-6681-201; 5'UTR (exon 2)
Database links

Mature sequence gga-miR-6681-5p

Accession MIMAT0025786
Sequence

27 - 

ucuggaucgagaaauucagcau

 - 48

Get sequence
Deep sequencing13 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).