Stem-loop sequence gga-mir-6682

AccessionMI0022503 (change log)
DescriptionGallus gallus miR-6682 stem-loop
Stem-loop
   ---    a    u     -a  g     u         gga  ag     -     a 
5'    acac ccug gcuuu  gu guggc ugccaccua   ug  ccaua uguuu u
      |||| |||| |||||  || ||||| |||||||||   ||  ||||| |||||  
3'    ugug ggau cgaga  cg caccg gcgguggau   ac  gguau guaaa a
   uac    c    -     ga  a     u         gaa  aa     u     u 
Get sequence
Deep sequencing
182 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr4: 21597361-21597470 [+]
sense
ENSGALT00000015322 ; GRIA2-201; intron 2
ENSGALT00000038841 ; GRIA2-202; intron 2
ENSGALT00000015320 ; GRIA2-203; intron 2
Database links

Mature sequence gga-miR-6682-3p

Accession MIMAT0025787
Sequence

64 - 

uggaacaaaguagguggcgugc

 - 85

Get sequence
Deep sequencing181 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).