Stem-loop sequence gga-mir-6683

AccessionMI0022504 (change log)
DescriptionGallus gallus miR-6683 stem-loop
Stem-loop
   -----aca  c      ucaa   gaa  g     ggu       u  g       uucu 
5'         gu uuuguc    agg   ac gcguu   cucccag cu uugguga    g
           || ||||||    |||   || |||||   ||||||| || |||||||     
3'         cg gaacag    ucc   ug ugcaa   gaggguc ga gacuacu    c
   caagacga  u      --ug   ---  g     -au       c  -       ucau 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr5: 30173954-30174063 [+]
sense
ENSGALT00000015704 ; gga-mir-6683-201; 3'UTR (exon 5)
Database links

Mature sequence gga-miR-6683-3p

Accession MIMAT0025788
Sequence

65 - 

ucagagccugggaguaaacgu

 - 85

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).