Stem-loop sequence gga-mir-6685

AccessionMI0022506 (change log)
DescriptionGallus gallus miR-6685 stem-loop
Stem-loop
   ----cauca   c  u   c      ----       a     -  u   a  cg 
5'          gcg ug acc gagcca    gcaaugc cgugu ac cag ga  g
            ||| || ||| ||||||    ||||||| ||||| || ||| ||   
3'          cgu ac ugg cuuggu    cguuacg gcgca ug guc cu  a
   acacacaca   u  -   a      ucgu       g     g  -   -  ua 
Get sequence
Deep sequencing
16 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr5: 25026259-25026358 [+]
intergenic
Database links

Mature sequence gga-miR-6685-5p

Accession MIMAT0025790
Sequence

21 - 

cagcaaugcacguguacucag

 - 41

Get sequence
Deep sequencing12 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6685-3p

Accession MIMAT0025791
Sequence

54 - 

uggugacgcgggcauugcugc

 - 74

Get sequence
Deep sequencing4 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).