Stem-loop sequence gga-mir-6686

AccessionMI0022507 (change log)
DescriptionGallus gallus miR-6686 stem-loop
Stem-loop
   cccucaccccuc    -c     -----a   -  g ug  gc        u    gaa 
5'             gcug  aggug      agc uc c  gg  ugcucugu ugcu   a
               ||||  |||||      ||| || |  ||  |||||||| ||||    
3'             ugac  ucuac      ucg ag g  cc  acgggacg acga   c
   ---ccgaccaaa    ua     acacag   c  a gu  ua        u    aca 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr14: 759895-760004 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-6686
gga-mir-6686chr14: 759895-760004 [+]
gga-mir-193bchr14: 764296-764378 [+]
gga-mir-365bchr14: 769102-769211 [-]
gga-mir-365-1chr14: 769114-769198 [+]
Database links

Mature sequence gga-miR-6686-3p

Accession MIMAT0025792
Sequence

65 - 

agggcaauccuggagacgcuga

 - 86

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).