Stem-loop sequence gga-mir-6687

AccessionMI0022508 (change log)
DescriptionGallus gallus miR-6687 stem-loop
Stem-loop
   ggagcggcggggaggggcggggcugaggagca       --g      c  ga   -   g 
5'                                 gagcccc   cggcgg cg  ucg ggc g
                                   |||||||   |||||| ||  ||| |||  
3'                                 cucgggg   gccguc gc  agc cug g
   ----------acggcaggccggacccccgccg       agg      a  -g   a   a 
Get sequence
Deep sequencing
40 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr3: 81786488-81786597 [-]
intergenic
Database links

Mature sequence gga-miR-6687-3p

Accession MIMAT0025793
Sequence

68 - 

agcgacugccgggaggggcucgc

 - 90

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).