Stem-loop sequence gga-mir-6688

AccessionMI0022509 (change log)
DescriptionGallus gallus miR-6688 stem-loop
Stem-loop
   gucacac    aac   c    -----ugcc     uuuu     u            au 
5'        caua   ugc ugau         aaguc    uccuc gguggcucaggc  c
          ||||   ||| ||||         |||||    ||||| ||||||||||||   
3'        guau   acg auua         uucgg    aggag ccacugaguccg  g
   -ccugaa    --c   u    uuuuccuuu     ----     u            au 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr4: 21966872-21966981 [+]
intergenic
Database links

Mature sequence gga-miR-6688-3p

Accession MIMAT0025794
Sequence

63 - 

ugagucaccugaggaggcuuuu

 - 84

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).