Stem-loop sequence gga-mir-6689

AccessionMI0022510 (change log)
DescriptionGallus gallus miR-6689 stem-loop
Stem-loop
   guucuccugagccugacu  uua     a        c  a      - ug  u   u 
5'                   gc   cagug gguucugu ag gccauu c  gg ggu u
                     ||   ||||| |||||||| || |||||| |  || ||| c
3'                   cg   gucac ucaagacg uc cgguag g  cu ucg a
   -------ucccuucguuu  uca     g        c  g      u gu  -   u 
Get sequence
Deep sequencing
39 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr4: 3241204-3241313 [-]
sense
ENSGALT00000009621 ; KLHL13-201; intron 1
Database links

Mature sequence gga-miR-6689-3p

Accession MIMAT0025795
Sequence

70 - 

ugauggcgcucgcagaacugca

 - 91

Get sequence
Deep sequencing13 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).