Stem-loop sequence gga-mir-6690

AccessionMI0022511 (change log)
DescriptionGallus gallus miR-6690 stem-loop
Stem-loop
   ugucccaaacugguuca     u  cu         au    --u   -      g 
5'                  guugc cc  cagaagggg  ggcu   ugg cuccga c
                    ||||| ||  |||||||||  ||||   ||| |||||| a
3'                  uaacg gg  gucuuucuc  ucga   acu gaggcu g
   --ucuuccuauuggugg     u  ac         cg    cau   a      g 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr3: 107831726-107831835 [-]
sense
ENSGALT00000036722 ; CTSB-201; exon 6
Clustered miRNAs
< 10kb from gga-mir-6690
gga-mir-6702chr3: 107838931-107839040 [+]
gga-mir-6690chr3: 107831726-107831835 [-]
Database links

Mature sequence gga-miR-6690-5p

Accession MIMAT0025796
Sequence

27 - 

ucagaaggggauggcuuuggcuc

 - 49

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).