Stem-loop sequence gga-mir-6691-1

AccessionMI0022512 (change log)
DescriptionGallus gallus miR-6691-1 stem-loop
Gene family MIPF0001594; mir-6691
   -------------------------aa            g ugua    a  augaa      -g   u  u 
5'                            auccaucuccuu u    gugc ug     ccugcu  agc gc g
                              |||||||||||| |    |||| ||     ||||||  ||| ||  
3'                            uagguagaggga g    uacg ac     gggcgg  ucg cg c
   ggucuuuccaaauuaguagugaauuag            g ----    -  -----      ag   u  u 
Get sequence
Deep sequencing
9 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr7: 5793701-5793810 [+]
ENSGALT00000006583 ; SH3BP4-201; intron 3
Database links

Mature sequence gga-miR-6691-5p

Accession MIMAT0025797

21 - 


 - 42

Get sequence
Deep sequencing6 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets


PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).