Stem-loop sequence gga-mir-6692

AccessionMI0022513 (change log)
DescriptionGallus gallus miR-6692 stem-loop
Stem-loop
   aaaagaacauuucc          --uu      g   auag         g c     
5'               gcugcugcua    uuagua uug    guguguuug a uuau 
                 ||||||||||    |||||| |||    ||||||||| | ||| u
3'               cgaugacgau    agucau gac    cacacgaac u aauu 
   --agguucuaauau          ccau      g   ---a         g a     
Get sequence
Deep sequencing
3 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr10: 1126181-1126290 [-]
sense
ENSGALT00000003646 ; TRIP4-201; intron 11
Database links

Mature sequence gga-miR-6692-5p

Accession MIMAT0025798
Sequence

26 - 

uuuaguaguugauagguguguuugga

 - 51

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).