Stem-loop sequence gga-mir-6693

AccessionMI0022514 (change log)
DescriptionGallus gallus miR-6693 stem-loop
Stem-loop
   aaauaaagaauuuau   c        ac        c  uc    --    uucu 
5'                cua guuuguau  uuuguguc ag  cuga  augg    u
                  ||| ||||||||  |||||||| ||  ||||  ||||    u
3'                gau cggacaua  agacacag uc  gacu  uacu    a
   acagaaacauucauu   -        ca        -  -u    uu    uuaa 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr28: 4301639-4301748 [+]
antisense
ENSGALT00000005994 ; TMEM38A-201; intron 4
Database links

Mature sequence gga-miR-6693-3p

Accession MIMAT0025799
Sequence

65 - 

uuuucagucugacacagaacau

 - 86

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).