Stem-loop sequence gga-mir-6694

AccessionMI0022515 (change log)
DescriptionGallus gallus miR-6694 stem-loop
Stem-loop
   aca     aaga   u  ga    a       a  uc    a     aau  cauua 
5'    gcuug    ucc uu  gggg aacagaa cc  auuc uuaac   ga     u
      |||||    ||| ||  |||| ||||||| ||  |||| |||||   ||      
3'    cggac    agg ag  cccc uugucuu gg  ugag aauug   cu     u
   aca     ----   u  uc    c       a  ga    -     -gu  ccacu 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr6: 32650889-32650998 [-]
sense
ENSGALT00000046105 ; ADAM12-203; intron 8
ENSGALT00000020791 ; ADAM12-202; intron 11
ENSGALT00000045950 ; ADAM12-201; intron 12
Database links

Mature sequence gga-miR-6694-3p

Accession MIMAT0025800
Sequence

70 - 

uuaagaguagggauucuguucc

 - 91

Get sequence
Deep sequencing4 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).