Stem-loop sequence gga-mir-6695

AccessionMI0022516 (change log)
DescriptionGallus gallus miR-6695 stem-loop
Stem-loop
   -------------uaaug       gaaa a            a  -    -   acu   ca 
5'                   agauuuu    g gguugggaagga ca aagc aug   ugg  c
                     |||||||    | |||||||||||| || |||| |||   |||  a
3'                   ucugagg    c ccgacccuuccu gu uucg uac   acc  u
   cuaccgcaccuguuugcg       -gca a            c  c    g   ---   aa 
Get sequence
Deep sequencing
120 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr27: 1310053-1310162 [+]
sense
ENSGALT00000001615 ; WNT3-201; 3'UTR (exon 3)
Database links

Mature sequence gga-miR-6695-5p

Accession MIMAT0025801
Sequence

21 - 

uugggaaggaacaaagcaugacuu

 - 44

Get sequence
Deep sequencing116 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).