Stem-loop sequence gga-mir-6696

AccessionMI0022517 (change log)
DescriptionGallus gallus miR-6696 stem-loop
Stem-loop
   ------u  u   -   gaa   a        g   --u    - c     aggca 
5'        ca ucu gcu   gcg guagcugu auc   caag c cccac     g
          || ||| |||   ||| |||||||| |||   |||| | |||||      
3'        gu aga cga   cgu cgucgaca uag   guuc g gggug     c
   uacgucu  u   a   -aa   a        a   ucc    a a     agacu 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr17: 5228297-5228399 [+]
sense
Database links

Mature sequence gga-miR-6696-5p

Accession MIMAT0025802
Sequence

20 - 

agcugugaucucaagcccccac

 - 41

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6696-3p

Accession MIMAT0025803
Sequence

56 - 

gggagacuugccugauaacagcu

 - 78

Get sequence
Deep sequencing7 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).