Stem-loop sequence gga-mir-6697

AccessionMI0022518 (change log)
DescriptionGallus gallus miR-6697 stem-loop
Stem-loop
   -------------uuuucuuugugucagcug    a  aa    u         --gu  c 
5'                                uucc ag  caga gacaucagc    ga c
                                  |||| ||  |||| |||||||||    || a
3'                                gagg uc  guuu cuguagucg    cu c
   aguucauagucguguuacaaacguugucacu    a  cg    c         aagu  u 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr3: 58225142-58225251 [+]
sense
ENSGALT00000022702 ; ARHGAP18-201; intron 1
Database links

Mature sequence gga-miR-6697-5p

Accession MIMAT0025804
Sequence

20 - 

uccaagaacagaugacaucagc

 - 41

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).