Stem-loop sequence gga-mir-6698

AccessionMI0022519 (change log)
DescriptionGallus gallus miR-6698 stem-loop
Stem-loop
   -----aac    -g gaa        ca  -       gua   uc u      ugguc 
5'         ggaa  c   caauucca  uu cuucuca   ucu  c cugacc     u
           ||||  |   ||||||||  || |||||||   |||  | ||||||      
3'         ccuu  g   guugaggu  aa gaagagu   aga  g gauugg     c
   uaaaagga    ga acc        ug  u       --g   ga -      ugaaa 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr2: 68054394-68054503 [+]
sense
ENSGALT00000021007 ; VPS4B-201; 3'UTR (exon 6)
Database links

Mature sequence gga-miR-6698-3p

Accession MIMAT0025805
Sequence

62 - 

uuaggagagagugagaaguaagu

 - 84

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).