Stem-loop sequence gga-mir-6699

AccessionMI0022521 (change log)
DescriptionGallus gallus miR-6699 stem-loop
Stem-loop
   ----------agcaa  a     acuc    c   -ug    c  c   c        uu 
5'                gc uuggc    uccu uug   aaga cu gug auuguagc  u
                  || |||||    |||| |||   |||| || ||| ||||||||  g
3'                cg aaccg    agga aac   uucu ga cac uaacaucg  c
   aagugaagguagaca  g     --aa    a   uga    a  u   a        ua 
Get sequence
Deep sequencing
39 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr3: 67609936-67610045 [-]
sense
ENSGALT00000024698 ; LACE1-201; intron 2
Database links

Mature sequence gga-miR-6699-5p

Accession MIMAT0025808
Sequence

26 - 

ugaagaccucgugcauuguagc

 - 47

Get sequence
Deep sequencing34 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).