Stem-loop sequence gga-mir-6700

AccessionMI0022522 (change log)
DescriptionGallus gallus miR-6700 stem-loop
Stem-loop
   ---a        aaga      gagggagc    auu    a      ----    c   g 
5'     gccuuauu    gcagcu        uggg   guuc ggagag    gagg uca g
       ||||||||    ||||||        ||||   |||| ||||||    |||| |||  
3'     uggagugg    ugucga        acuc   caag ucucuc    uucc agu u
   gagg        ----      --agggaa    -au    a      acua    -   g 
Get sequence
Deep sequencing
779 reads, 100 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 59412540-59412648 [-]
intergenic
Database links

Mature sequence gga-miR-6700-5p

Accession MIMAT0025809
Sequence

27 - 

cugggauuguucaggagaggaggc

 - 50

Get sequence
Deep sequencing50 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6700-3p

Accession MIMAT0025810
Sequence

66 - 

ucacucucuagaacuacucaaagg

 - 89

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).