Stem-loop sequence gga-mir-6701

AccessionMI0022523 (change log)
DescriptionGallus gallus miR-6701 stem-loop
Stem-loop
   caaauccuuccaaua   caga    ug          c   c      cc  ------g g 
5'                ggc    ugag  aagugaucug cug aaagua  cc       g a
                  |||    ||||  |||||||||| ||| ||||||  ||       |  
3'                ccg    acuc  uucgcuagac gac uuuuau  gg       c a
   ------cccacucga   ----    cu          a   a      ua  acaaaaa a 
Get sequence
Deep sequencing
6 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr2: 97511155-97511264 [-]
intergenic
Database links

Mature sequence gga-miR-6701-3p

Accession MIMAT0025811
Sequence

70 - 

auuauuuuacagacagaucgc

 - 90

Get sequence
Deep sequencing6 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).