Stem-loop sequence gga-mir-6702

AccessionMI0022524 (change log)
DescriptionGallus gallus miR-6702 stem-loop
Stem-loop
   ----------------------cuaugauucua       ucac    gca   ua      u  ag 
5'                                  cguggcc    cagg   gag  gaggug gu  u
                                    |||||||    ||||   |||  |||||| ||   
3'                                  gcaccgg    gucc   cuc  cuccac cg  a
   ccgguuacccuaggaccccccguaauuuuccuc       --uc    -aa   -c      u  ag 
Get sequence
Deep sequencing
197 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr3: 107838931-107839040 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-6702
gga-mir-6690chr3: 107831726-107831835 [-]
gga-mir-6702chr3: 107838931-107839040 [+]
Database links

Mature sequence gga-miR-6702-5p

Accession MIMAT0025812
Sequence

20 - 

caccagggcagaguagaggugug

 - 42

Get sequence
Deep sequencing186 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).