Stem-loop sequence gga-mir-6703

AccessionMI0022525 (change log)
DescriptionGallus gallus miR-6703 stem-loop
Stem-loop
   cugcaagugcaugagcuuucaccacuuaaaccagac         uccccc      u   a 
5'                                     ugcuguccu      agcucu ccu u
                                       |||||||||      |||||| |||  
3'                                     acgacagga      ucgaga gga c
   --------------gcgagaacgacaucguugaaac         --uguc      c   a 
Get sequence
Deep sequencing
9 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr10: 2448422-2448531 [-]
antisense
ENSGALT00000002121 ; gga-mir-6703-201; 3'UTR (exon 1)
Database links

Mature sequence gga-miR-6703-3p

Accession MIMAT0025813
Sequence

69 - 

cagagcucuguaggacagcaca

 - 90

Get sequence
Deep sequencing7 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).