Stem-loop sequence gga-mir-6704

AccessionMI0022526 (change log)
DescriptionGallus gallus miR-6704 stem-loop
Stem-loop
   --------------gccua  c    gc      --           ga   --a   - ug u 
5'                    ag caag  cucaca  acacagagagg  cag   gua g  c g
                      || ||||  ||||||  |||||||||||  |||   ||| |  | u
3'                    uc guuc  gagugu  ugugucuuuuc  guc   cau c  g a
   ucuuuaacgcaaucuucaa  u    --      uu           uc   gua   a gu a 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr4: 8680293-8680402 [+]
intergenic
Database links

Mature sequence gga-miR-6704-5p

Accession MIMAT0025814
Sequence

20 - 

aacacagagagggacagaguag

 - 41

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).