Stem-loop sequence gga-mir-6705

AccessionMI0022527 (change log)
DescriptionGallus gallus miR-6705 stem-loop
Literature search

1 open access papers mention gga-mir-6705
(4 sentences)

Stem-loop
   ---ugga  aua   ag u   u     -a      --g gg a        ugu ag 
5'        ga   uga  a cau cuggg  agcaau   g  u aggaacag   g  u
          ||   |||  | ||| |||||  ||||||   |  | ||||||||   |   
3'        cu   acu  u gua gaccc  ucguug   c  g uccuuguc   c  u
   gaagaca  --g   cu u   c     ac      uga uu g        uuc uu 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gga-miR-6705-5p

Accession MIMAT0025815
Sequence

26 - 

aagcaaugggguaaggaacag

 - 46

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).