Stem-loop sequence gga-mir-6707

AccessionMI0022529 (change log)
DescriptionGallus gallus miR-6707 stem-loop
Stem-loop
   uuugcuuu   g   acag        ca   ug   g a   g  ac  a      uu 
5'         gag aug    uacuggaa  agc  ccu g gag uu  ag aucucc  c
           ||| |||    ||||||||  |||  ||| | ||| ||  || ||||||   
3'         cuc uac    gugaccuu  ucg  gga c cuc aa  uc uagagg  u
   -------u   a   -aau        --   ua   a a   g  ac  g      uc 
Get sequence
Deep sequencing
17 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr2: 107155775-107155884 [+]
intergenic
Database links

Mature sequence gga-miR-6707-5p

Accession MIMAT0025817
Sequence

21 - 

acuggaacaagcugccuggagagg

 - 44

Get sequence
Deep sequencing9 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).