Stem-loop sequence gga-mir-6708

AccessionMI0022530 (change log)
DescriptionGallus gallus miR-6708 stem-loop
Stem-loop
   ----------------aggau      gca     u     a g  c    a    c   aca 
5'                      gaugga   gagcc auggg g ag ggug gcag agc   g
                        ||||||   ||||| ||||| | || |||| |||| |||   c
3'                      cuaccu   cucgg uaccc u uc ccgc cguc ucg   a
   caccucgccggcgccacgacc      -ac     -     c g  -    c    c   acu 
Get sequence
Deep sequencing
9 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 292474-292583 [+]
sense
ENSGALT00000043996 ; SHANK3-201; intron 16
Database links

Mature sequence gga-miR-6708-5p

Accession MIMAT0025818
Sequence

20 - 

uaugggaggagcggugagcagca

 - 42

Get sequence
Deep sequencing7 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).