Stem-loop sequence gga-mir-6709

AccessionMI0022531 (change log)
DescriptionGallus gallus miR-6709 stem-loop
Stem-loop
   ----       guucc  ugac            g  ugcu   a      a  ug  g 
5'     cugagcg     uc    cagaggcagccc gc    aac augagg ga  gc u
       |||||||     ||    |||||||||||| ||    ||| |||||| ||  || g
3'     gacucgc     ag    guuuucgucggg cg    uug ugcucc cu  ug u
   acuc       -gccu  ---c            a  --uc   g      -  uu  u 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr11: 615293-615402 [-]
sense
ENSGALT00000001797 ; COQ9-201; intron 6
Database links

Mature sequence gga-miR-6709-5p

Accession MIMAT0025819
Sequence

26 - 

agcccggcugcuaacaaugaggaga

 - 50

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).