Stem-loop sequence gga-mir-6710

AccessionMI0022532 (change log)
DescriptionGallus gallus miR-6710 stem-loop
Stem-loop
   gagguuaccuguacucgguagcagaccugaagug       ucu        agug     u 
5'                                   agguggg   gaggauag    gauau u
                                     |||||||   ||||||||    |||||  
3'                                   ucuaccu   cucuuguc    cuaug g
   -------------uuaccuugagggaggagccga       --u        -aaa     u 
Get sequence
Deep sequencing
58 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr2: 728233-728342 [-]
sense
ENSGALT00000008045 ; DHX30-201; exon 5
Database links

Mature sequence gga-miR-6710-3p

Accession MIMAT0025820
Sequence

71 - 

aaacuguucucuuccaucuag

 - 91

Get sequence
Deep sequencing54 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).