Stem-loop sequence gga-mir-6711

AccessionMI0022533 (change log)
DescriptionGallus gallus miR-6711 stem-loop
Stem-loop
   -u   a a   a        -  ga    -ca     ga           ca   gcc 
5'   gca g uuu uuccuuuc gu  gcug   cuugg  uugagaagaag  aga   u
     ||| | ||| |||||||| ||  ||||   |||||  |||||||||||  |||    
3'   cgu c gaa aaggaaag ca  ugac   gaauc  agcucuuuuuc  uuu   g
   uu   - -   -        a  -a    aua     ug           -c   agu 
Get sequence
Deep sequencing
16 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr3: 10070501-10070610 [-]
sense
ENSGALT00000014275 ; SPRED2-201; intron 3
Database links

Mature sequence gga-miR-6711-5p

Accession MIMAT0025821
Sequence

28 - 

cacuugggauugagaagaagca

 - 49

Get sequence
Deep sequencing16 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).