Stem-loop sequence gga-mir-6712

AccessionMI0022534 (change log)
DescriptionGallus gallus miR-6712 stem-loop
Stem-loop
   -------------gccagcacugugccuucccgaccca    --        --aa     a 
5'                                       gugg  uggcugag    cagug c
                                         ||||  ||||||||    ||||| c
3'                                       cacc  accggcuc    gucac a
   ucguuacgacguuggaguccuuccucucggaggacgag    cu        ccuc     g 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr17: 10000998-10001107 [-]
antisense
ENSGALT00000001570 ; OLFML2A-201; intron 2
Database links

Mature sequence gga-miR-6712-5p

Accession MIMAT0025822
Sequence

25 - 

agugguggcugagaacagugac

 - 46

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).