Stem-loop sequence gga-mir-6713

AccessionMI0022535 (change log)
DescriptionGallus gallus miR-6713 stem-loop
Stem-loop
   uaucagcauuacagcuucucuggaaaagaagcuguaaucaucaguguu    cucag      -   ---     caa     c 
5'                                                 gcca     ugagau cac   ugcau   gcagu u
                                                   ||||     |||||| |||   |||||   |||||  
3'                                                 cggu     auuuua gug   acgua   cguca c
   ------------------------------------------------    -----      u   ucu     ---     a 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr2: 2521303-2521412 [-]
sense
ENSGALT00000031303 ; WNT3A-201; intron 2
ENSGALT00000031304 ; WNT3A-202; intron 2
Database links

Mature sequence gga-miR-6713-3p

Accession MIMAT0025823
Sequence

26 - 

aagaagcuguaaucauca

 - 43

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).