Stem-loop sequence gga-mir-6714

AccessionMI0022536 (change log)
DescriptionGallus gallus miR-6714 stem-loop
Stem-loop
   ugcuguccagcuuuugcagcu     cu       -         g a  c     u cau 
5'                      aaggg  gugaagu ccuuuucua a ca agucu g   u
                        |||||  ||||||| ||||||||| | || ||||| |    
3'                      uuccu  uacuuua ggaaaaggu u gu ucaga c   c
   ------------cuacaaacu     cu       c         g c  -     c cuu 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gga-miR-6714-3p

Accession MIMAT0025824
Sequence

70 - 

acuugcuguggaaaaggcauuu

 - 91

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).