Stem-loop sequence gga-mir-6622

AccessionMI0022537 (change log)
DescriptionGallus gallus miR-6622 stem-loop
Stem-loop
   agggcuggagggagacagcagccaaauuccau   g     --g      u     a aa 
5'                                 cca aggaa   ucccac gacug g  a
                                   ||| |||||   |||||| ||||| |   
3'                                 ggu ucuuu   ggggug cugac c  g
   ---------aaucgguaaaaugggaguuuuac   g     aca      u     - cg 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr8: 22245941-22246050 [-]
intergenic
Database links

Mature sequence gga-miR-6622-3p

Accession MIMAT0025825
Sequence

69 - 

uguggggacauuucuguggcauu

 - 91

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).