Stem-loop sequence gga-mir-6644-1

AccessionMI0022538 (change log)
DescriptionGallus gallus miR-6644-1 stem-loop
Gene family MIPF0001504; mir-6644
Stem-loop
   gcaggauucacccugag     ucac       --g                     c 
5'                  agacg    auggcuu   guuguaccaucuuagcccccu c
                    |||||    |||||||   ||||||||||||||||||||| u
3'                  ucugc    uacugag   cgacaugguagaaucgggggg a
   ------uuacccuggag     -uuc       agg                     a 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gga-miR-6644-3p

Accession MIMAT0025745
Sequence

63 - 

ggggcuaagaugguacagcgga

 - 84

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).